Example Program
Smith-Waterman Algorithm
Smith-Waterman local alignment code example.
File "graph_align_sw.cpp"
This code example illustrates a graph-based Smith-Waterman alignment
1#include <seqan/graph_align.h>
2#include <iostream>
3
4using namespace seqan;
5
6int main() {
7    typedef String<Dna> TString;
8    typedef StringSet<TString, Dependent<> > TStringSet;
9    typedef Graph<Alignment<TStringSet, Dna> > TGraph;
Alignments are carried out on a StringSet that holds the sequences
10    TStringSet str;
11    TString str0("TTGACACCCTCCCAATTGTA"); appendValue(str, str0);
12    TString str1("ACCCCAGGCTTTACACAT"); appendValue(str, str1);
Configuration of alignment algorithm: Scoring (Match = 2, Mismatch = -1, Gap-extension = -1, Gap-opening = -2)
13    Score<int> score_type = Score<int>(2,-1,-1,-2);
We could again use a graph to retrieve the local alignment, but as with all other alignment algorithms we can also use a string of fragments or simply std::cout.
14    typedef Fragment<> TFragment;
15    typedef String<TFragment> TFragmentString;
16    TFragmentString matches;
Local alignment with Smith-Waterman
17    int score = localAlignment(matches, str, score_type, SmithWaterman() );
Console output
18    std::cout << "Scoring schema: Match=2, Mismatch=-1, Gap-extension=-1, Gap-opening=-2" << std::endl;
19    std::cout << str0 << std::endl;
20    std::cout << str1 << std::endl;
21    std::cout << "Local match: " << std::endl;
22    std::cout << label(matches[0], str, 0) << std::endl;
23    std::cout << label(matches[0], str, 1) << std::endl;
24    std::cout << "Score: " << score << std::endl;
25    return 0;
26}
27
SeqAn - Sequence Analysis Library - www.seqan.de